File Formats
Supported input formats:
Input files may not contain headers.
ELAND:
at least five columns.
|
1 |
2 |
3 |
4 |
5 |
Fields: |
read sequence |
ignored |
ignored |
chromosome number:start location (two fields, colon-separated) |
strand (F or R) |
Example: TGAGTGAGGTGTGGGCTCCACACCC 12500 1 chr19:4124128 F
Extended ELAND:
at least four columns.
|
1 |
2 |
3 |
4 |
Fields: |
ignored |
read sequence |
ignored |
chromosome file:start location, strand (chromosome file as chr#.fa, colon, start location, followed immediately by strand (F or R) |
Example: >HWI-EAS435:4:1:2:1706#0/1 GGATGGAGTGCAGTGCTGCAATCATGGTTCACTGAA 0:1:86 chr12.fa:121208577R15G20
BED:
at least six columns.
|
1 |
2 |
3 |
4 |
5 |
6 |
Fields: |
chromosome (chr#) |
read start |
read end |
ignored |
ignored |
strand (+ or -) |
Example: chr2 33925682 33925706 U0 0 -
SAM:
at least ten columns.
|
1 |
2 |
3 |
4 |
5 |
6 |
7 |
8 |
9 |
10 |
Fields: |
ignored |
SAM flag (column must be present) |
chromosome (chr#) |
read start |
ignored |
ignored |
ignored |
ignored |
read sequence |
ignored |
Example: >HWI-EAS435_0007:2:1:0:1314#0 16 chr1 30740220 0 36M * 0 0 GGTATCAGTGATGGAAGACGAAATGAATGGAATGANcccccccccccccccccccccccccccccccccccc XT:A:R NM:i:2 X0:i:7 X1:i:0 XM:i:2 XO:i:0 XG:i:0 MD:Z:29A5A0
BAM:
samtools-encoded binary SAM.
GFF:
at least six columns,
tab separated.
|
1 |
2 |
3 |
4 |
5 |
6 |
Fields: |
ignored |
ignored |
chromosome (single number) |
strand (+ or -) |
read start |
read end |
Example: Seq_4383668 ChIPSeq 1 + 559765 559799
bowtie:
at least five columns.
|
1 |
2 |
3 |
4 |
5 |
Fields: |
ignored |
strand (+ or -) |
chromosome (chr#) |
read start |
sequence |
Example: 853_8_11_F3 - chr15 71397686 GCTGTCTGCCCCTGTGCTGGGAGCATTCTATCACTGAC 79-%%*>1)656/:H7)3?BHID<G;7AGECIH25KB 0
Custom:
If a custom format is chosen, specify the columns of the chromosome ID, strand, starting coordinate and ending coordinate, with 1 being the leftmost column. Strand must be either + or -, and chromosome ID must be specified as chr#.
